-
PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of a PTC-containing beta-globin reporter.
-
Depositing Lab
-
Depositing OrganizationYale University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 85444 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 85444-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 85444-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbone2073 nt of YCplac33
- Backbone size w/o insert (bp) 2073
- Total vector size (bp) 15294
-
Vector typeMammalian Expression ; minimal backbone fragment for low-copy bacterial propagation
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nametDNA1 EF1alfa-5xtdTomato-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-HygromycinR
-
Insert Size (bp)13215
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (destroyed during cloning)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer 5'- GTGAGTTAGCTCACTCATTAGGCACCC -3'
- 3′ sequencing primer 5'- GTT CCG CGC ACA TTT CCC -3'
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 85444-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 85444-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Fireworks RFP[PTC+] (AVA2626) was a gift from Joan Steitz (Addgene plasmid # 85444 ; http://n2t.net/addgene:85444 ; RRID:Addgene_85444) -
For your References section:
Fluorescence Amplification Method for Forward Genetic Discovery of Factors in Human mRNA Degradation. Alexandrov A, Shu MD, Steitz JA. Mol Cell. 2017 Jan 5;65(1):191-201. doi: 10.1016/j.molcel.2016.11.032. Epub 2016 Dec 22. 10.1016/j.molcel.2016.11.032 PubMed 28017590