Skip to main content

Fireworks GFP[PTC+] (AVA2600)
(Plasmid #85446)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 85446 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 85446-D50 50 μg of DNA in Tris buffer $495
DNA 85446-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    2073 nt of YCplac33
  • Backbone size w/o insert (bp) 2073
  • Total vector size (bp) 11448
  • Vector type
    Mammalian Expression ; minimal backbone fragment for low-copy bacterial propagation
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tDNA1 EF1alfa-5xEGFP-TEVprotease-PEST-beta-globin(dI1)(PTC39)-BGH polyA tDNA2 FRT-PEST-TEVsite-PuromycinR
  • Insert Size (bp)
    9369

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (destroyed during cloning)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer 5'- GTGAGTTAGCTCACTCATTAGGCACCC -3'
  • 3′ sequencing primer 5'- GTT CCG CGC ACA TTT CCC -3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Fireworks GFP[PTC+] (AVA2600) was a gift from Joan Steitz (Addgene plasmid # 85446 ; http://n2t.net/addgene:85446 ; RRID:Addgene_85446)
  • For your References section:

    Fluorescence Amplification Method for Forward Genetic Discovery of Factors in Human mRNA Degradation. Alexandrov A, Shu MD, Steitz JA. Mol Cell. 2017 Jan 5;65(1):191-201. doi: 10.1016/j.molcel.2016.11.032. Epub 2016 Dec 22. 10.1016/j.molcel.2016.11.032 PubMed 28017590