Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Launchpad (AVA2590)
(Plasmid #85442)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 85442 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTYF
  • Backbone size w/o insert (bp) 6458
  • Total vector size (bp) 10503
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    FRT-flanked EF1alfa-GFP PGK-Puromycin cassette
  • Species
    EGFP: Aequorea victoria
  • Insert Size (bp)
    4045

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer 5'- gtagacataatagcaacagac -3'
  • 3′ sequencing primer 5'- GAA AGG ACA GTG GGA GTG GCA C -3'
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Launchpad (AVA2590) was a gift from Joan Steitz (Addgene plasmid # 85442 ; http://n2t.net/addgene:85442 ; RRID:Addgene_85442)
  • For your References section:

    Fluorescence Amplification Method for Forward Genetic Discovery of Factors in Human mRNA Degradation. Alexandrov A, Shu MD, Steitz JA. Mol Cell. 2017 Jan 5;65(1):191-201. doi: 10.1016/j.molcel.2016.11.032. Epub 2016 Dec 22. 10.1016/j.molcel.2016.11.032 PubMed 28017590