Opto-GPR146
(Plasmid
#106047)
-
PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR146; Opto-GPR146; E1)
-
Depositing Lab
-
Depositing OrganizationInstitute of Science and Technology Austria (I.S.T. Austria)
Located in Austria -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 106047 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 106047-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 106047-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1-
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5427
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOpto-GPR146
-
SpeciesH. sapiens (human), B. taurus (bovine)
-
Insert Size (bp)1143
-
MutationChimeric receptor protein
-
Entrez GeneGPR146 (a.k.a. PGR8)
- Promoter CMV
-
Tags
/ Fusion Proteins
- VSV-G (N terminal on insert)
- Rhodopsin-1D4 (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer CMV_F (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer pcDNA_R (CAACAGATGGCTGGCAAC)
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
two step cloning; 5' and 3' sites cannot be used for (sub)cloning
DNA (Catalog # 106047-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 106047-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Opto-GPR146 was a gift from Harald Janovjak (Addgene plasmid # 106047 ; http://n2t.net/addgene:106047 ; RRID:Addgene_106047) -
For your References section:
Optical functionalization of human Class A orphan G-protein-coupled receptors. Morri M, Sanchez-Romero I, Tichy AM, Kainrath S, Gerrard EJ, Hirschfeld PP, Schwarz J, Janovjak H. Nat Commun. 2018 May 16;9(1):1950. doi: 10.1038/s41467-018-04342-1. 10.1038/s41467-018-04342-1 PubMed 29769519