Skip to main content

pSB3C5-proD-B0032-E0051
(Plasmid #107241)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 107241 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 107241-D50 50 μg of DNA in Tris buffer $495
DNA 107241-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSB3C5
  • Backbone manufacturer
    http://parts.igem.org/Part:pSB3C5
  • Backbone size w/o insert (bp) 2738

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ProA-RBS(B0032)-Gemini (E0051)
  • Alt name
    see partsregistry.org for more information
  • Species
    Synthetic
  • Insert Size (bp)
    1500
  • Promoter proD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB3C5-proD-B0032-E0051 was a gift from Joseph Davis & Robert Sauer (Addgene plasmid # 107241 ; http://n2t.net/addgene:107241 ; RRID:Addgene_107241)
  • For your References section:

    Design, construction and characterization of a set of insulated bacterial promoters. Davis JH, Rubin AJ, Sauer RT. Nucleic Acids Res. 2011 Feb;39(3):1131-41. doi: 10.1093/nar/gkq810. Epub 2010 Sep 15. 10.1093/nar/gkq810 PubMed 20843779