pSB3C5-proD-B0032-E0051
(Plasmid
#107241)
-
PurposeExpresses lacZa-GFP fusion from constitutive proD promoter
-
Depositing Labs
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107241 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 107241-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 107241-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepSB3C5
-
Backbone manufacturerhttp://parts.igem.org/Part:pSB3C5
- Backbone size w/o insert (bp) 2738
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameProA-RBS(B0032)-Gemini (E0051)
-
Alt namesee partsregistry.org for more information
-
SpeciesSynthetic
-
Insert Size (bp)1500
- Promoter proD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 107241-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 107241-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSB3C5-proD-B0032-E0051 was a gift from Joseph Davis & Robert Sauer (Addgene plasmid # 107241 ; http://n2t.net/addgene:107241 ; RRID:Addgene_107241) -
For your References section:
Design, construction and characterization of a set of insulated bacterial promoters. Davis JH, Rubin AJ, Sauer RT. Nucleic Acids Res. 2011 Feb;39(3):1131-41. doi: 10.1093/nar/gkq810. Epub 2010 Sep 15. 10.1093/nar/gkq810 PubMed 20843779
