Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSB3C5-proC-B0032-E0051
(Plasmid #107242)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107242 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB3C5
  • Backbone manufacturer
    http://parts.igem.org/Part:pSB3C5
  • Backbone size w/o insert (bp) 2738

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    ProC-RBS(B0032)-Gemini (E0051)
  • Alt name
    see partsregistry.org for more information
  • Insert Size (bp)
    1500
  • Promoter proC

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSB3C5-proC-B0032-E0051 was a gift from Joseph Davis & Robert Sauer (Addgene plasmid # 107242 ; http://n2t.net/addgene:107242 ; RRID:Addgene_107242)
  • For your References section:

    Design, construction and characterization of a set of insulated bacterial promoters. Davis JH, Rubin AJ, Sauer RT. Nucleic Acids Res. 2011 Feb;39(3):1131-41. doi: 10.1093/nar/gkq810. Epub 2010 Sep 15. 10.1093/nar/gkq810 PubMed 20843779