-
PurposepJL1 expression vector with sfGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 69496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC18
- Backbone size w/o insert (bp) 1763
- Total vector size (bp) 2486
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSuper folder GFP
-
Alt namesfGFP
-
Insert Size (bp)723
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccacaacggtttccctctag
- 3′ sequencing primer aactcagcttcctttcgggc (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Articles Citing this Plasmid
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1 was a gift from Michael Jewett (Addgene plasmid # 69496 ; http://n2t.net/addgene:69496 ; RRID:Addgene_69496)