-
PurposepJL1 expression vector with sfGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 69496 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC18
- Backbone size w/o insert (bp) 1763
- Total vector size (bp) 2486
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSuper folder GFP
-
Alt namesfGFP
-
Insert Size (bp)723
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ccacaacggtttccctctag
- 3′ sequencing primer aactcagcttcctttcgggc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJL1 was a gift from Michael Jewett (Addgene plasmid # 69496 ; http://n2t.net/addgene:69496 ; RRID:Addgene_69496) -
For your References section:
Cell-free protein synthesis from genomically recoded bacteria enables multisite incorporation of noncanonical amino acids. Martin RW, Des Soye BJ, Kwon YC, Kay J, Davis RG, Thomas PM, Majewska NI, Chen CX, Marcum RD, Weiss MG, Stoddart AE, Amiram M, Ranji Charna AK, Patel JR, Isaacs FJ, Kelleher NL, Hong SH, Jewett MC. Nat Commun. 2018 Mar 23;9(1):1203. doi: 10.1038/s41467-018-03469-5. 10.1038/s41467-018-03469-5 PubMed 29572528