Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pHCAG-L2EOP
(Plasmid #51783)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 51783 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHCAG amplicon vector
  • Backbone manufacturer
    pHCAG generated from our laboratory
  • Backbone size w/o insert (bp) 7786
  • Total vector size (bp) 13120
  • Modifications to backbone
    Insertion of luc2EBNA-1
  • Vector type
    herpes simplex virus type-1 amplicon vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Luciferase-2A-EBNA-1
  • Alt name
    L2EOP
  • Species
    EBV and firefly
  • Insert Size (bp)
    2972
  • Promoter CAG

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer 5’ ATCATGTCTGACGAGGGCCC 3’
  • 3′ sequencing primer 5’ GCTAGCCCTTTATGTGTAACTCTT 3’
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    OriP
  • Alt name
    OriP
  • Species
    EBV
  • Insert Size (bp)
    1973

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The EBNA-1/OriP elements were synthesized using PCR from pREP7 (Invitrogen).

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

We would like to acknowledge, as a reference to depositing this plasmid, that the completed plasmid sequence is performed by Axil Scientific Sequencing , primer walking.

Addgene sequencing results find several discrepancies within the full plasmid sequence, they are not believed to effect the function of the plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHCAG-L2EOP was a gift from Paula Lam (Addgene plasmid # 51783 ; http://n2t.net/addgene:51783 ; RRID:Addgene_51783)
  • For your References section:

    Hybrid herpes simplex virus/Epstein-Barr virus amplicon viral vectors confer enhanced transgene expression in primary human tumors and human bone marrow-derived mesenchymal stem cells. Sia KC, Chong WK, Ho IA, Yulyana Y, Endaya B, Huynh H, Lam PY. J Gene Med. 2010 Oct;12(10):848-58. doi: 10.1002/jgm.1506. 10.1002/jgm.1506 PubMed 20963807