-
PurposeExpresses high specificity SpCas9. Px330-like plasmid.
-
Depositing Lab
-
Publication
-
Citations
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 71814 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
-
Backbone manufacturerFeng Zhang lab (Addgene plasmid #42230)
- Total vector size (bp) 8506
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenhanced specificity Cas9 (1.1)
-
Alt nameeSpCas9(1.1)
-
SpeciesS. pyogenes
-
MutationK848A, K1003A, & R1060A
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
eSpCas9(1.1) was a gift from Feng Zhang (Addgene plasmid # 71814 ; http://n2t.net/addgene:71814 ; RRID:Addgene_71814) -
For your References section:
Rationally engineered Cas9 nucleases with improved specificity. Slaymaker IM, Gao L, Zetsche B, Scott DA, Yan WX, Zhang F. Science. 2015 Dec 1. pii: aad5227. 10.1126/science.aad5227 PubMed 26628643
Map uploaded by the depositor.
