pBAD-Ag43
(Plasmid
#107743)
-
PurposeExpresses Ag43 under the control of an L-arabinose transcriptional regulator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 107743 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneBBa_I0500-pSB4A3
-
Backbone manufactureriGEM BioBricks
- Backbone size w/o insert (bp) 4549
- Total vector size (bp) 7833
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameAg43
-
Alt nameflu
-
Insert Size (bp)3284
-
Mutationremoved all pstI cut sites with silent mutations, added RBS and terminator
-
Entrez Geneflu (a.k.a. b2000, ECK1993, agn, agn43, yeeQ, yzzX)
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (destroyed during cloning)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer attaccgcctttgagtgagc
- 3′ sequencing primer GCGGTCGGTCGATAAAAAAATCG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byiGEM BioBricks BBa_K346007
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Ag43 contains a G981S variant compared to the NCBI reference (WP_000820410.1); plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-Ag43 was a gift from Ingmar Riedel-Kruse (Addgene plasmid # 107743 ; http://n2t.net/addgene:107743 ; RRID:Addgene_107743) -
For your References section:
Biofilm Lithography enables high-resolution cell patterning via optogenetic adhesin expression. Jin X, Riedel-Kruse IH. Proc Natl Acad Sci U S A. 2018 Apr 3;115(14):3698-3703. doi: 10.1073/pnas.1720676115. Epub 2018 Mar 19. 10.1073/pnas.1720676115 PubMed 29555779