Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDawn-Ag43
(Plasmid #107742)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 107742 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDawn
  • Backbone manufacturer
    Andreas Moeglich Lab
  • Backbone size w/o insert (bp) 7293
  • Total vector size (bp) 10440
  • Modifications to backbone
    replaced KanR with specR
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ag43
  • Alt name
    flu
  • Insert Size (bp)
    3147
  • Mutation
    removed all pstI cut sites with silent mutations, added RBS
  • Entrez Gene
    flu (a.k.a. b2000, ECK1993, agn, agn43, yeeQ, yzzX)
  • Promoter pLambda

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ctctggcggtgataatggttgc
  • 3′ sequencing primer GAGCCCCCGATTTAGAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    iGEM BioBricks BBa_K346007
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Ag43 contains a G981S variant compared to the NCBI reference (WP_000820410.1); plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDawn-Ag43 was a gift from Ingmar Riedel-Kruse (Addgene plasmid # 107742 ; http://n2t.net/addgene:107742 ; RRID:Addgene_107742)
  • For your References section:

    Biofilm Lithography enables high-resolution cell patterning via optogenetic adhesin expression. Jin X, Riedel-Kruse IH. Proc Natl Acad Sci U S A. 2018 Apr 3;115(14):3698-3703. doi: 10.1073/pnas.1720676115. Epub 2018 Mar 19. 10.1073/pnas.1720676115 PubMed 29555779