Skip to main content

pIRESneo-FLAG/HA Ago2 corrected
(Plasmid #10822)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 10822 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 10822-D50 50 μg of DNA in Tris buffer $495
DNA 10822-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pIRESneo
  • Backbone size w/o insert (bp) 5310
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Argonaute 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2580
  • Mutation
    3 silent mutations in orf
  • GenBank ID
    NM_012154
  • Entrez Gene
    AGO2 (a.k.a. CASC7, EIF2C2, LESKRES, LINC00980, PPD, Q10)
  • Tags / Fusion Proteins
    • FLAG (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ggtaccgagctcggatcgat
  • 3′ sequencing primer agctgttggggtgagtactcc
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIRESneo-FLAG/HA Ago2 corrected was a gift from Thomas Tuschl (Addgene plasmid # 10822 ; http://n2t.net/addgene:10822 ; RRID:Addgene_10822)
  • For your References section:

    Human Argonaute2 mediates RNA cleavage targeted by miRNAs and siRNAs. Meister G, Landthaler M, Patkaniowska A, Dorsett Y, Teng G, Tuschl T. Mol Cell. 2004 Jul 23. 15(2):185-97. 10.1016/j.molcel.2004.07.007 PubMed 15260970