pcDNA5/FRT/TO-globin_del5UTR_PTC39-xrRNA-4H
(Plasmid
#108376)
-
PurposeFRT integration of beta-globin reporter with premature termination codon (PTC39); enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)
-
Depositing Lab
-
Depositing OrganizationUniversitaet zu Koeln
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 108376 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 108376-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 108376-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA5/FRT/TO
-
Backbone manufacturerThermo Fisher Scientific
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTC39 beta-globin reporter with MVE xrRNA and 4H probe binding sites
-
SpeciesH. sapiens (human)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see depositor's genbank file in Supplemental Documents for full annotation of the plasmid
DNA (Catalog # 108376-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 108376-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5/FRT/TO-globin_del5UTR_PTC39-xrRNA-4H was a gift from Niels Gehring (Addgene plasmid # 108376 ; http://n2t.net/addgene:108376 ; RRID:Addgene_108376) -
For your References section:
Interrogating the degradation pathways of unstable mRNAs with XRN1-resistant sequences. Boehm V, Gerbracht JV, Marx MC, Gehring NH. Nat Commun. 2016 Dec 5;7:13691. doi: 10.1038/ncomms13691. 10.1038/ncomms13691 PubMed 27917860