-
PurposeMPRA v3 minimal promoter with GFP donor
-
Depositing Labs
-
Depositing OrganizationJackson Laboratory
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109036 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 109036-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 109036-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepGL4.23
-
Backbone manufacturerPromega
- Total vector size (bp) 3356
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameemGFP
-
Insert Size (bp)726
- Promoter minP
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGTGAGCAAGGGCGA
- 3′ sequencing primer TTATCATTACTTGTACAGCTCGTCCATGC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 109036-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 109036-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMPRAv3:minP-GFP was a gift from Pardis Sabeti & Ryan Tewhey (Addgene plasmid # 109036 ; http://n2t.net/addgene:109036 ; RRID:Addgene_109036) -
For your References section:
Direct Identification of Hundreds of Expression-Modulating Variants using a Multiplexed Reporter Assay. Tewhey R, Kotliar D, Park DS, Liu B, Winnicki S, Reilly SK, Andersen KG, Mikkelsen TS, Lander ES, Schaffner SF, Sabeti PC. Cell. 2016 Jun 2;165(6):1519-29. doi: 10.1016/j.cell.2016.04.027. 10.1016/j.cell.2016.04.027 PubMed 27259153