pcDNA3 RL3m6L2
(Plasmid
#109366)
-
PurposeHuman rod opsin chimera with intracellular loop 3 replaced by intracellular loop 2 of mGluR6 with 1D4 tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109366 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5323
- Total vector size (bp) 6367
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRhodopsin chimera with mGluR6 intracellular loop 2 at intracellular loop 3 position
-
Alt nameRL3m6L2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1044
-
GenBank IDNM_000539.3 NM_000843.3
-
Entrez GeneGRM6 (a.k.a. CSNB1B, GPRC1F, MGLUR6, mGlu6)
-
Entrez GeneRHO (a.k.a. CSNBAD1, OPN2, RP4)
- Promoter CMV
-
Tag
/ Fusion Protein
- 1D4 (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGAGGTCTATATAAGCAGAGC
- 3′ sequencing primer ggcaccttccagggtcaagg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3 RL3m6L2 was a gift from Robert Lucas (Addgene plasmid # 109366 ; http://n2t.net/addgene:109366 ; RRID:Addgene_109366) -
For your References section:
A live cell assay of GPCR coupling allows identification of optogenetic tools for controlling Go and Gi signaling. Ballister ER, Rodgers J, Martial F, Lucas RJ. BMC Biol. 2018 Jan 16;16(1):10. doi: 10.1186/s12915-017-0475-2. 10.1186/s12915-017-0475-2 PubMed 29338718