pEM705 Gso (Cys)
(Plasmid
#109375)
-
PurposeGsX chimera with Gαo C-terminus (Pertussis toxin sensitive)
-
Depositing Lab
-
Depositing OrganizationUniversity of Manchester
Located in United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 109375 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 109375-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 109375-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEM705
- Backbone size w/o insert (bp) 6002
- Total vector size (bp) 7184
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGso chimera
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1182
-
MutationCys at position 391 (Pertussis Toxin Sensitive)
-
GenBank ID
- Promoter CAG
-
Tag
/ Fusion Protein
- None
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttctggcgtgtgaccggcggctc
- 3′ sequencing primer TTGGCAGAGGGAAAAAGATCTCAGTGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 109375-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 109375-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEM705 Gso (Cys) was a gift from Robert Lucas (Addgene plasmid # 109375 ; http://n2t.net/addgene:109375 ; RRID:Addgene_109375) -
For your References section:
A live cell assay of GPCR coupling allows identification of optogenetic tools for controlling Go and Gi signaling. Ballister ER, Rodgers J, Martial F, Lucas RJ. BMC Biol. 2018 Jan 16;16(1):10. doi: 10.1186/s12915-017-0475-2. 10.1186/s12915-017-0475-2 PubMed 29338718