Skip to main content

pEGFP-N1_MeCP2(R306C)
(Plasmid #110188)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110188 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 110188-D50 50 μg of DNA in Tris buffer $495
DNA 110188-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4680
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MeCP2_e2 FL [R306C] (mouse cDNA)
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1469
  • Mutation
    Arg 306 Cys
  • Entrez Gene
    Mecp2 (a.k.a. 1500041B07Rik, D630021H01Rik, Mbd5, WBP10)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer aaatgtcgtaacaactccgc
  • 3′ sequencing primer acaaaccacaactagaatgcag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-N1_MeCP2(R306C) was a gift from Adrian Bird (Addgene plasmid # 110188 ; http://n2t.net/addgene:110188 ; RRID:Addgene_110188)
  • For your References section:

    Radically truncated MeCP2 rescues Rett syndrome-like neurological defects. Tillotson R, Selfridge J, Koerner MV, Gadalla KKE, Guy J, De Sousa D, Hector RD, Cobb SR, Bird A. Nature. 2017 Oct 19;550(7676):398-401. doi: 10.1038/nature24058. Epub 2017 Oct 11. 10.1038/nature24058 PubMed 29019980