Skip to main content

pEGFP-h53BP1 (siRNA resistant)
(Plasmid #110301)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 110301 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 110301-D50 50 μg of DNA in Tris buffer $495
DNA 110301-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP
  • Backbone manufacturer
    Clontech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    p53-binding protein 1
  • Species
    H. sapiens (human)
  • Mutation
    GAACGAGGA to GAGCGGGGC
  • Entrez Gene
    TP53BP1 (a.k.a. 53BP1, TDRD30, p202, p53BP1)
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site unknown (unknown if destroyed)
  • 3′ cloning site unknown (unknown if destroyed)
  • 5′ sequencing primer unknown
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-h53BP1 (siRNA resistant) was a gift from Chris Kok-Lung Chan (Addgene plasmid # 110301 ; http://n2t.net/addgene:110301 ; RRID:Addgene_110301)
  • For your References section:

    53BP1 can limit sister-chromatid rupture and rearrangements driven by a distinct ultrafine DNA bridging-breakage process. Tiwari A, Addis Jones O, Chan KL. Nat Commun. 2018 Feb 14;9(1):677. doi: 10.1038/s41467-018-03098-y. 10.1038/s41467-018-03098-y [pii] PubMed 29445165