-
PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)
-
Depositing Lab
-
Depositing OrganizationUniversity of Sussex
Located in United Kingdom of Great Britain and Northern Ireland -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110301 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 110301-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 110301-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP
-
Backbone manufacturerClontech
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namep53-binding protein 1
-
SpeciesH. sapiens (human)
-
MutationGAACGAGGA to GAGCGGGGC
-
Entrez GeneTP53BP1 (a.k.a. 53BP1, TDRD30, p202, p53BP1)
-
Tag
/ Fusion Protein
- EGFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer unknown
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG
DNA (Catalog # 110301-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 110301-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-h53BP1 (siRNA resistant) was a gift from Chris Kok-Lung Chan (Addgene plasmid # 110301 ; http://n2t.net/addgene:110301 ; RRID:Addgene_110301) -
For your References section:
53BP1 can limit sister-chromatid rupture and rearrangements driven by a distinct ultrafine DNA bridging-breakage process. Tiwari A, Addis Jones O, Chan KL. Nat Commun. 2018 Feb 14;9(1):677. doi: 10.1038/s41467-018-03098-y. 10.1038/s41467-018-03098-y [pii] PubMed 29445165