Addgene: 53BP1 can limit sister-chromatid rupture and rearrangements driven by a distinct ultrafine DNA bridging-breakage process.

This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

53BP1 can limit sister-chromatid rupture and rearrangements driven by a distinct ultrafine DNA bridging-breakage process.
Tiwari A, Addis Jones O, Chan KL
Nat Commun. 2018 Feb 14;9(1):677. doi: 10.1038/s41467-018-03098-y. PubMed

Plasmids from Article

ID	Plasmid	Purpose
110301	pEGFP-h53BP1 (siRNA resistant)	Mammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)
110302	pSpCas9(BB)-T2A-Puro_h53BP1_gRNA_D	Expresssion of Cas9-T2A-puromycin resistant gene and a gRNA targeting exon 10 of human 53BP1

Plasmids from Article

Antibodies from Article

Help Center

Deposit Plasmids

General Reagents

Viral Service

DNA Service

Plasmid Collections

	More than 20 requests
	More than 50 requests
	More than 100 requests