-
PurposeminiTn7 delivery plasmid with lacIq-Ptac inducible promoter
-
Depositing Lab
-
Depositing OrganizationEmory University
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110558 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC18T-miniTn7T-gm
-
Backbone manufacturerHerbert Schweizer
- Backbone size w/o insert (bp) 4569
- Total vector size (bp) 6058
-
Vector typeBacterial Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namelacIq-Ptac
-
Insert Size (bp)1513
-
GenBank IDKX782328
- Promoter lacIq-Ptac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer LacI-R
- 3′ sequencing primer Tn7-end (GGGGTGGAAATGGAGTTTTT )
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJM101(pUC18T-miniTn7T-gm-lacIq-Ptac) was a gift from Joanna Goldberg (Addgene plasmid # 110558 ; http://n2t.net/addgene:110558 ; RRID:Addgene_110558) -
For your References section:
The Escherichia coli rhaSR-PrhaBAD Inducible Promoter System Allows Tightly Controlled Gene Expression over a Wide Range in Pseudomonas aeruginosa. Meisner J, Goldberg JB. Appl Environ Microbiol. 2016 Oct 27;82(22):6715-6727. doi: 10.1128/AEM.02041-16. Print 2016 Nov 15. 10.1128/AEM.02041-16 PubMed 27613678