Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJM220 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD)
(Plasmid #110559)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 110559 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUC18T-miniTn7T-gm
  • Backbone manufacturer
    Herbert Schweizer
  • Backbone size w/o insert (bp) 4569
  • Total vector size (bp) 6700
  • Vector type
    Bacterial Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    rhaSR-PrhaBAD
  • Insert Size (bp)
    2149
  • GenBank ID
    KX777256
  • Promoter rhaSR-PrhaBAD

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SacI (not destroyed)
  • 3′ cloning site PstI (not destroyed)
  • 5′ sequencing primer oJM730 (gatacagcgtgaattttcagg)
  • 3′ sequencing primer Tn7-end (GGGGTGGAAATGGAGTTTTT)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM220 (pUC18T-miniTn7T-gm-rhaSR-PrhaBAD) was a gift from Joanna Goldberg (Addgene plasmid # 110559 ; http://n2t.net/addgene:110559 ; RRID:Addgene_110559)
  • For your References section:

    The Escherichia coli rhaSR-PrhaBAD Inducible Promoter System Allows Tightly Controlled Gene Expression over a Wide Range in Pseudomonas aeruginosa. Meisner J, Goldberg JB. Appl Environ Microbiol. 2016 Oct 27;82(22):6715-6727. doi: 10.1128/AEM.02041-16. Print 2016 Nov 15. 10.1128/AEM.02041-16 PubMed 27613678