C. difficile 16S toehold switch sensor
(Plasmid
#110704)
-
PurposeToehold switch sensor to detect the V3 hypervariable region of the 16S rRNA with GFP output
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110704 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 110704-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 110704-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCOLA
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameC. difficile 16S toehold switch sensor
- Promoter T7
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttcaccaccctgaattgactc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 110704-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 110704-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
C. difficile 16S toehold switch sensor was a gift from James Collins (Addgene plasmid # 110704 ; http://n2t.net/addgene:110704 ; RRID:Addgene_110704) -
For your References section:
A low-cost paper-based synthetic biology platform for analyzing gut microbiota and host biomarkers. Takahashi MK, Tan X, Dy AJ, Braff D, Akana RT, Furuta Y, Donghia N, Ananthakrishnan A, Collins JJ. Nat Commun. 2018 Aug 21;9(1):3347. doi: 10.1038/s41467-018-05864-4. 10.1038/s41467-018-05864-4 PubMed 30131493