pEN35-CDKN2A-Ex2-R
(Plasmid
#110737)
-
PurposeEncodes Cas9 nickase and gRNA targeting CDKN2A Exon2
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 110737 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 110737-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 110737-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEN35
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDKN2A gRNA
-
gRNA/shRNA sequenceGACCCGTGCACGACGCTGCCCGG
-
SpeciesH. sapiens (human)
-
Entrez GeneCDKN2A (a.k.a. ARF, CAI2, CDK4I, CDKN2, CMM2, INK4, INK4A, MLM, MTS-1, MTS1, P14, P14ARF, P16, P16-INK4A, P16INK4, P16INK4A, P19, P19ARF, TP16)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 110737-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 110737-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN35-CDKN2A-Ex2-R was a gift from Robert Judson-Torres (Addgene plasmid # 110737 ; http://n2t.net/addgene:110737 ; RRID:Addgene_110737) -
For your References section:
Bi-allelic Loss of CDKN2A Initiates Melanoma Invasion via BRN2 Activation. Zeng H, Jorapur A, Shain AH, Lang UE, Torres R, Zhang Y, McNeal AS, Botton T, Lin J, Donne M, Bastian IN, Yu R, North JP, Pincus L, Ruben BS, Joseph NM, Yeh I, Bastian BC, Judson RL. Cancer Cell. 2018 Jul 9;34(1):56-68.e9. doi: 10.1016/j.ccell.2018.05.014. 10.1016/j.ccell.2018.05.014 PubMed 29990501