Skip to main content

pCMV-dLight1.3b
(Plasmid #111056)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111056 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 111056-D50 50 μg of DNA in Tris buffer $495
DNA 111056-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEGFP_N1
  • Backbone size w/o insert (bp) 3983
  • Total vector size (bp) 6029
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dLight1.3b
  • Species
    Synthetic
  • Insert Size (bp)
    2046
  • GenBank ID
    MH244552
  • Tag / Fusion Protein
    • Flag tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gtggatagcggtttgactcacgggg
  • 3′ sequencing primer ggtgtgggaggttttttaaagcaagtaaaacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-dLight1.3b was a gift from Lin Tian (Addgene plasmid # 111056 ; http://n2t.net/addgene:111056 ; RRID:Addgene_111056)
  • For your References section:

    Ultrafast neuronal imaging of dopamine dynamics with designed genetically encoded sensors. Patriarchi T, Cho JR, Merten K, Howe MW, Marley A, Xiong WH, Folk RW, Broussard GJ, Liang R, Jang MJ, Zhong H, Dombeck D, von Zastrow M, Nimmerjahn A, Gradinaru V, Williams JT, Tian L. Science. 2018 Jun 29;360(6396). pii: science.aat4422. doi: 10.1126/science.aat4422. Epub 2018 May 31. 10.1126/science.aat4422 PubMed 29853555