pSEMS-Halo7Tag-hFis
(Plasmid #111136)

• Purpose: hFis with selflabeling tag, e.g. for fluorescence microscopy
• Depositing Lab: Karin Busch
• Publication: Appelhans et al Nano Lett. 2012 Feb 8;12(2):610-6. doi: 10.1021/nl203343a. Epub 2012 Jan 13.

Backbone

• Vector backbone: pSEMS(26m)
• Backbone manufacturer: Covalys, NEB
• Backbone size w/o insert (bp): 5325
• Total vector size (bp): 6584
• Modifications to backbone: original snap-Tag substituted by Halo7-Tag
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: human fission factor1
• Alt name: hFis1
• Species: H. sapiens (human)
• Insert Size (bp): 459
• Mutation: *
• GenBank ID: NM_016068.2
• Entrez Gene: FIS1 (a.k.a. CGI-135, TTC11)
• Promoter: CMV
• Tag / Fusion Protein:
  • Halo7-tag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SbfI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: ATGGAGGCCGTGCTGAACGAGCT
• 3′ sequencing primer: TCAGGATTTGGACTTGGACACAGCAA

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • HaloTag Vector Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*Addgene QC found a V9E substitution in hFis1