Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSEMS-Tom20-Halo7Tag
(Plasmid #111135)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 111135 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSEMS(26m)
  • Backbone manufacturer
    Covalys, NEB
  • Backbone size w/o insert (bp) 5325
  • Total vector size (bp) 6570
  • Modifications to backbone
    original snap-Tag substituted by Halo7-Tag
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Receptor of tranlocase of outer mitochondrial membrane Tom20
  • Alt name
    Tom20
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    435
  • Entrez Gene
    TOMM20 (a.k.a. MAS20, MOM19, TOM20)
  • Promoter CMV
  • Tag / Fusion Protein
    • Halo7 Tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGGTGGGTCGGAACAGCGCCAT
  • 3′ sequencing primer TTCCACATCATCTTCAGCCAAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEMS-Tom20-Halo7Tag was a gift from Karin Busch (Addgene plasmid # 111135 ; http://n2t.net/addgene:111135 ; RRID:Addgene_111135)
  • For your References section:

    Nanoscale organization of mitochondrial microcompartments revealed by combining tracking and localization microscopy. Appelhans T, Richter CP, Wilkens V, Hess ST, Piehler J, Busch KB. Nano Lett. 2012 Feb 8;12(2):610-6. doi: 10.1021/nl203343a. Epub 2012 Jan 13. 10.1021/nl203343a PubMed 22201267