Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #108973)


Item Catalog # Description Quantity Price (USD)
Plasmid 108973 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Covalys, NEB
  • Backbone size w/o insert (bp) 5325
  • Total vector size (bp) 6978
  • Modifications to backbone
    original snap-Tag substituted by Halo7-Tag
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    succinate dehydrogenase complex iron sulfur subunit B
  • Alt name
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
    SDHB (a.k.a. CWS2, IP, MC2DN4, PGL4, SDH, SDH1, SDH2, SDHIP)
  • Promoter CMV
  • Tag / Fusion Protein
    • Halo7-tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ATGGCGGCGGTGGTCGCACTCTC
  • 3′ sequencing primer CCGAACTGAAGCTTTCTTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEMS-SDHB-Halo7Tag was a gift from Karin Busch (Addgene plasmid # 108973 ; ; RRID:Addgene_108973)
  • For your References section:

    Restricted diffusion of OXPHOS complexes in dynamic mitochondria delays their exchange between cristae and engenders a transitory mosaic distribution. Wilkens V, Kohl W, Busch K. J Cell Sci. 2013 Jan 1;126(Pt 1):103-16. doi: 10.1242/jcs.108852. Epub 2012 Oct 4. 10.1242/jcs.108852 PubMed 23038773