Skip to main content

33-G-X1-pEF1-puro
(Plasmid #111604)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 111604 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 111604-D50 50 μg of DNA in Tris buffer $495
DNA 111604-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pEF1-puro
  • Backbone size w/o insert (bp) 7400
  • Total vector size (bp) 9400
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human LRRC33 and GARP chimeria
  • Alt name
    NRROS
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2000
  • Entrez Gene
    NRROS (a.k.a. ELLP3030, GARPL1, LRRC33, UNQ3030)
  • Promoter EF1a
  • Tag / Fusion Protein
    • Flag tag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TGGAGGAACAGAAGCGGAACA
  • 3′ sequencing primer GGCTTTATACTGTTGGTTAAACTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    33-G-X1-pEF1-puro was a gift from Timothy Springer (Addgene plasmid # 111604 ; http://n2t.net/addgene:111604 ; RRID:Addgene_111604)
  • For your References section:

    A Milieu Molecule for TGF-beta Required for Microglia Function in the Nervous System. Qin Y, Garrison BS, Ma W, Wang R, Jiang A, Li J, Mistry M, Bronson RT, Santoro D, Franco C, Robinton DA, Stevens B, Rossi DJ, Lu C, Springer TA. Cell. 2018 Jun 28;174(1):156-171.e16. doi: 10.1016/j.cell.2018.05.027. Epub 2018 Jun 14. 10.1016/j.cell.2018.05.027 PubMed 29909984