pAGM4723:Ble:Cas9
(Plasmid #112208)

• Purpose: Golden Gate Level 2 construct encoding Cas9-YFP, Zeocin resistance.
• Depositing Lab: Thomas Mock
• Publication: Mock lab P. tricornutum plasmids (unpublished)

Backbone

• Vector backbone: pAGM4723-Del
• Vector type: CRISPR ; Diatom, Phaeodactylum
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4860
• Mutation: Phaeodactylum Fcp promoter
• Promoter: Phaeodactylum Fcp
• Tag / Fusion Protein:
  • YFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: cattacggacgagtacaaggtg

Gene/Insert 2

• Gene/Insert name: SheBle
• Alt name: Bleomycin resistance protein
• Insert Size (bp): 857
• Promoter: Phaeodactylum Fcp
• Tag / Fusion Protein:
  • Phaeodactylum fcp promoter and terminator

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: gagACATACCTTCAGCGTCGTC

Resource Information

• Supplemental Documents:
  • L2 no sgRNA.gb
• A portion of this plasmid was derived from a plasmid made by: pPha-TI plasmid, described in Zaslavskaia L, Lippmeier C, Kroth P. Grossman A, Apt Kirk. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. Was domesticated by removing and BpiI sites through site directed mutagenesis from the FCP promoter and terminator, was then inserted into an L1 pICH47732 vector. Cas9:YFP described in Hopes A, Nekrasov V, Kamoun S, Mock T. Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning.
Contains Zeocin resistance and Cas 9, for Phaeodactylum transformation. Can be used with sgRNA's on a separate plasmid or as a control.
Plasmid was construct according to Hopes 2016 (Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana)