pAGM4723:Ble:Cas9
(Plasmid #112208)

• Purpose: Golden Gate Level 2 construct encoding Cas9-YFP, Zeocin resistance.
• Depositing Lab: Thomas Mock
• Depositing Organization: University of East Anglia
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Mock lab P. tricornutum plasmids (unpublished)

Backbone

• Vector backbone: pAGM4723-Del
• Vector type: CRISPR ; Diatom, Phaeodactylum
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: Cas9
• Species: Streptococcus pyogenes
• Insert Size (bp): 4860
• Mutation: Phaeodactylum Fcp promoter
• Promoter: Phaeodactylum Fcp
• Tag / Fusion Protein:
  • YFP (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: cattacggacgagtacaaggtg

Gene/Insert 2

• Gene/Insert name: SheBle
• Alt name: Bleomycin resistance protein
• Insert Size (bp): 857
• Promoter: Phaeodactylum Fcp
• Tag / Fusion Protein:
  • Phaeodactylum fcp promoter and terminator

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: BpiI (destroyed during cloning)
• 3′ cloning site: BpiI (destroyed during cloning)
• 5′ sequencing primer: gagACATACCTTCAGCGTCGTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pPha-TI plasmid, described in Zaslavskaia L, Lippmeier C, Kroth P. Grossman A, Apt Kirk. Transformation of the diatom Phaeodactylum tricornutum (Bacillariophyceae) with a variety of selectable marker and reporter genes. Was domesticated by removing and BpiI sites through site directed mutagenesis from the FCP promoter and terminator, was then inserted into an L1 pICH47732 vector. Cas9:YFP described in Hopes A, Nekrasov V, Kamoun S, Mock T. Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This construct was assembled using Golden Gate Cloning.
Contains Zeocin resistance and Cas 9, for Phaeodactylum transformation. Can be used with sgRNA's on a separate plasmid or as a control.
Plasmid was construct according to Hopes 2016 (Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana)

DNA (Catalog # 112208-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 112208-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.