pAGM4723:TpCC_Urease
(Plasmid
#85982)
-
PurposeGolden Gate Level 2 construct encoding Cas9-YFP and 2 urease-targeting gRNAs
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 85982 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAGM4723
-
Backbone manufacturerSylvestre Marillonnet (Addgene #48015)
-
Vector typeCRISPR ; Diatom (T. pseudonana)
-
Selectable markersNourseothricin (Nat)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
SpeciesStreptococcus pyogenes
- Promoter FCP
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- YFP (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer hSpCas9-R1 (CGCTCGTGCTTCTTATCCTC)
- 3′ sequencing primer EXFP-R (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameUrease-targeting gRNA 1
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer Unknown
- 3′ sequencing primer RB-F1 (ggataaaccttttcacgccc) (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameUrease-targeting gRNA 2
- Promoter U6
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer Unknown
- 3′ sequencing primer RB-F1 (ggataaaccttttcacgccc) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe cassette from pTpFCP/NAT described in Poulsen N, Chesley PM, Kröger N. Molecular genetic manipulation of the diatom Thalassiosira pseudonana (Bacillariophyceae), was domesticated by removing BsaI and BpiI sites through site directed mutagenesis. This was then used as a template for the FCP promoter and terminator. The sgRNA scaffold was PCR amplified from Addgene #46966.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct was assembled using Golden Gate Cloning as described in Hopes et al., 2016.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAGM4723:TpCC_Urease was a gift from Thomas Mock (Addgene plasmid # 85982 ; http://n2t.net/addgene:85982 ; RRID:Addgene_85982) -
For your References section:
Editing of the urease gene by CRISPR-Cas in the diatom Thalassiosira pseudonana. Hopes A, Nekrasov V, Kamoun S, Mock T. Plant Methods. 2016 Nov 24;12:49. doi: 10.1186/s13007-016-0148-0. eCollection 2016. 10.1186/s13007-016-0148-0 PubMed 27904648