pCAG-tdTHC
(Plasmid
#112621)
-
Purposeexpression plasmid with CAG promoter driving multicistronic cassette H2BtdTomato_p2A_HygroR_p2A_CreERt2
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112621 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepromoterless backbone from pd2EGFP-1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3110
- Total vector size (bp) 10563
-
Modifications to backboneCAG promoter inserted at MCS
-
Vector typeMammalian Expression, Cre/Lox
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameH2B-tdTomato
-
Alt nameHIST1H2BB, H2B.1, H2B/f, H2BFF, MGC119804
-
Alt nametdTomato
-
SpeciesH. sapiens (human); Anthozoa
-
Insert Size (bp)1812
-
GenBank IDNM_021058
-
Entrez GeneH2BC3 (a.k.a. H2B.1, H2B/f, H2BFF, HIST1H2BB)
- Promoter CAG
-
Tag
/ Fusion Protein
- tdTomato (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer AAAGAATTCATGAGGCCGGCC
- 3′ sequencing primer TGAAGTTAGTAGCTCCGCTTCC
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHygrophosphotransferase
-
Alt nameHygroR
-
Alt namehygromycin-B
-
SpeciesCoccidioides posadasii C735 delta SOWgp
-
Insert Size (bp)1023
-
GenBank IDXM_003071606
- Promoter CAG
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer atgaaaaagcctgaactcaccgc
- 3′ sequencing primer ttcctttgccctcggacga
- (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameCre-ERT2 fusion protein
-
SpeciesBacteriophage P1
-
Insert Size (bp)1983
- Promoter CAG
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCCAATTTACTGACCGTACA
- 3′ sequencing primer TCAAGCTGTGGCAGGGAAACC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byH2B was cloned from Addgene plasmid 26750, tdTomato was cloned from Addgene plasmid 26123, HygroR was cloned from Addgene plasmid 28226, CreERT2 and Rabbit betaglobin PolyA were cloned from Addgene plasmid 14797, CAG was cloned from Addgene plasmid 14797
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
CAG promoter driving multicistronic reporter plasmid containing H2BtdTomato, HygroR, and CreERT2 in a single ORF with two P2A sequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-tdTHC was a gift from Stefan Heller (Addgene plasmid # 112621 ; http://n2t.net/addgene:112621 ; RRID:Addgene_112621) -
For your References section:
Fbxo2(VHC) mouse and embryonic stem cell reporter lines delineate in vitro-generated inner ear sensory epithelia cells and enable otic lineage selection and Cre-recombination. Hartman BH, Bscke R, Ellwanger DC, Keymeulen S, Scheibinger M, Heller S. Dev Biol. 2018 Sep 1. pii: S0012-1606(18)30499-8. doi: 10.1016/j.ydbio.2018.08.013. 10.1016/j.ydbio.2018.08.013 PubMed 30179592