-
PurposeExpresses YFP-KRAS4B fusion protein used for FRET studies in eukaryotic cells.
-
Depositing Lab
-
Depositing OrganizationUniversity of Texas Southwestern Medical Center
Located in the United States of America -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 112718 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 112718-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 112718-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
-
Backbone manufacturerThermoFisher Scientific
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameYFP-KRAS4B
-
Alt nameenhanced yellow fluorescent protein-Kirsten ras oncogene
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1317
-
Entrez GeneKRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RALD2, RASK2, c-Ki-ras, c-Ki-ras2)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CMV Forward: CGCAAATGGGCGGTAGGCCTG
- 3′ sequencing primer BGH Reverse: TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 112718-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 112718-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-YFP-KRAS4B was a gift from Kenneth Westover (Addgene plasmid # 112718 ; http://n2t.net/addgene:112718 ; RRID:Addgene_112718) -
For your References section:
KRAS Dimerization Impacts MEK Inhibitor Sensitivity and Oncogenic Activity of Mutant KRAS. Ambrogio C, Kohler J, Zhou ZW, Wang H, Paranal R, Li J, Capelletti M, Caffarra C, Li S, Lv Q, Gondi S, Hunter JC, Lu J, Chiarle R, Santamaria D, Westover KD, Janne PA. Cell. 2018 Feb 8;172(4):857-868.e15. doi: 10.1016/j.cell.2017.12.020. Epub 2018 Jan 11. 10.1016/j.cell.2017.12.020 PubMed 29336889