Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCrysβ:ECFP-LexOP:mCherry-KrasG12V
(Plasmid #89888)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 89888 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDs(cry:C-LOP:Ch)
  • Backbone size w/o insert (bp) 6260
  • Total vector size (bp) 7585
  • Vector type
    Unspecified

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry-KRasG12V
  • Species
    H. sapiens (human), Synthetic
  • Tag / Fusion Protein
    • mCherry (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCGACTCTAGGATCTTCGCA
  • 3′ sequencing primer GGGAGGTGTGGGAGGTTTT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pDs(cry:ECFP-LexOP:Cherry) construct was from Dr Alexander Emelyanov and Dr Sergey Parinov (Emelyanov and Parinov, 2008). pEFm.6 HA-KRasv12 was from Prof Xin Lu.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCrysβ:ECFP-LexOP:mCherry-KrasG12V was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 89888 ; http://n2t.net/addgene:89888 ; RRID:Addgene_89888)
  • For your References section:

    Generation of a double binary transgenic zebrafish model to study myeloid gene regulation in response to oncogene activation in melanocytes. Kenyon A, Gavriouchkina D, Zorman J, Chong-Morrison V, Napolitani G, Cerundolo V, Sauka-Spengler T. Dis Model Mech. 2018 Apr 6;11(4). pii: dmm.030056. doi: 10.1242/dmm.030056. 10.1242/dmm.030056 PubMed 29666124