pClodAcytCh-GFP-P4M
(Plasmid #113346)

• Purpose: Bacterial expression of Cherry and GFP-SidM-P4M domain (2 copies)
• Depositing Lab: Sanford Simon
• Publication: Botero et al Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar.

Backbone

• Vector backbone: pClodA
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Cherry
• Species: Synthetic
• Promoter: proD

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGAGTCAGGCAACTATGGATGA
• 3′ sequencing primer: gtgtccgcagcgctAGATCT

Gene/Insert 2

• Gene/Insert name: GFP-SidM-P4M domain (2 copies of P4M in tandem)
• Promoter: ProD

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tgctgtgctctgcgaaagccagt
• 3′ sequencing primer: CACCTGACGTCTAAGAAACCAT

Resource Information

• Supplemental Documents:
  • pClodAcytCh-GFP-P4M.gbk
• A portion of this plasmid was derived from a plasmid made by: Dr. Tamas Balla of the Program for Developmental Neuroscience at NIH, kindly provided the original plasmid with the GFP-P4M-SidMx2 containing plasmid as a reporter for PI4P localization(42). We obtained this last plasmid through Addgene (plasmid #51472).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry