Skip to main content

pClodAcytCh-GFP-P4M
(Plasmid #113346)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 113346 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pClodA
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    Cherry
  • Species
    Synthetic
  • Promoter proD

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGAGTCAGGCAACTATGGATGA
  • 3′ sequencing primer gtgtccgcagcgctAGATCT
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    GFP-SidM-P4M domain (2 copies of P4M in tandem)
  • Promoter ProD

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgctgtgctctgcgaaagccagt
  • 3′ sequencing primer CACCTGACGTCTAAGAAACCAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Tamas Balla of the Program for Developmental Neuroscience at NIH, kindly provided the original plasmid with the GFP-P4M-SidMx2 containing plasmid as a reporter for PI4P localization(42). We obtained this last plasmid through Addgene (plasmid #51472).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pClodAcytCh-GFP-P4M was a gift from Sanford Simon (Addgene plasmid # 113346 ; http://n2t.net/addgene:113346 ; RRID:Addgene_113346)
  • For your References section:

    Escherichia coli as a platform for the study of phosphoinositide biology. Botero S, Chiaroni-Clarke R, Simon SM. Sci Adv. 2019 Mar 27;5(3):eaat4872. doi: 10.1126/sciadv.aat4872. eCollection 2019 Mar. 10.1126/sciadv.aat4872 PubMed 30944849