aav-SYN-tdNfsB(F124W)-mCherry (eNTR)
(Plasmid
#113760)
-
PurposeAAV-mediated expression of bacterial tdNfsB-mCherry (eNTR) under the SYN promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 113760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV2
- Total vector size (bp) 6366
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsStabl2 or Stabl3, 30C or 37C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nametdNfsB(F124W)-mCherry
-
Alt namenfsb, eNTR
-
SpeciesE. coli
-
Insert Size (bp)2109
-
MutationF124W
- Promoter Synapsin
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgggcgcgaccatctgc
- 3′ sequencing primer aaggcattaaagcagcgtatc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
aav-SYN-tdNfsB(F124W)-mCherry (eNTR) was a gift from Luke Lavis (Addgene plasmid # 113760 ; http://n2t.net/addgene:113760 ; RRID:Addgene_113760) -
For your References section:
Cell-Specific Chemical Delivery Using a Selective Nitroreductase-Nitroaryl Pair. Gruber TD, Krishnamurthy C, Grimm JB, Tadross MR, Wysocki LM, Gartner ZJ, Lavis LD. ACS Chem Biol. 2018 Aug 29. doi: 10.1021/acschembio.8b00524. 10.1021/acschembio.8b00524 PubMed 30111097