-
PurposeLentivirus compatible SpCas9/dCas9 sgRNA scaffold driven by the U6 promoter and mCherry driven by the EF1a promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 114199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesgRNA scaffold
- Promoter U6
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCTTGGGTAGTTTGCAGTTTT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene #47108 adapted into lentivirus backbone and insertion of EF1a mCherry . Please visit https://www.biorxiv.org/content/early/2018/07/17/371500 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lenti U6-sgRNA/EF1a-mCherry was a gift from Jeremy Day (Addgene plasmid # 114199 ; http://n2t.net/addgene:114199 ; RRID:Addgene_114199) -
For your References section:
A Neuron-Optimized CRISPR/dCas9 Activation System for Robust and Specific Gene Regulation. Savell KE, Bach SV, Zipperly ME, Revanna JS, Goska NA, Tuscher JJ, Duke CG, Sultan FA, Burke JN, Williams D, Ianov L, Day JJ. eNeuro. 2019 Mar 7;6(1). pii: eN-MNT-0495-18. doi: 10.1523/ENEURO.0495-18.2019. eCollection 2019 Jan-Feb. 10.1523/ENEURO.0495-18.2019 PubMed 30863790