Skip to main content

pCW-eGFP-FHA
(Plasmid #114129)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114129 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pCW57.1
  • Backbone manufacturer
    Addgene #41393
  • Backbone size w/o insert (bp) 7720
  • Total vector size (bp) 8932
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RNF8 FHA domain (amino acids 2-160)
  • Alt name
    hRNF8
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1212
  • Mutation
    aa 2-160
  • Entrez Gene
    RNF8 (a.k.a. hRNF8)
  • Promoter TRE promoter, Tet ON
  • Tag / Fusion Protein
    • eGFP (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer LNCX
  • 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW-eGFP-FHA was a gift from Daniel Durocher (Addgene plasmid # 114129 ; http://n2t.net/addgene:114129 ; RRID:Addgene_114129)
  • For your References section:

    The shieldin complex mediates 53BP1-dependent DNA repair. Noordermeer SM, Adam S, Setiaputra D, Barazas M, Pettitt SJ, Ling AK, Olivieri M, Alvarez-Quilon A, Moatti N, Zimmermann M, Annunziato S, Krastev DB, Song F, Brandsma I, Frankum J, Brough R, Sherker A, Landry S, Szilard RK, Munro MM, McEwan A, Goullet de Rugy T, Lin ZY, Hart T, Moffat J, Gingras AC, Martin A, van Attikum H, Jonkers J, Lord CJ, Rottenberg S, Durocher D. Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18. 10.1038/s41586-018-0340-7 PubMed 30022168