pCW-eGFP-FHA
(Plasmid
#114129)
-
PurposeLentiviral vector for inducible expression of eGFP-RNF8 FHA domain fusion; 53BP1-independent recruitment to damaged chromatin
-
Depositing Lab
-
Depositing OrganizationSinai Health System
Located in Canada -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
* Log in to view industry pricing.
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerAddgene #41393
- Backbone size w/o insert (bp) 7720
- Total vector size (bp) 8932
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameRNF8 FHA domain (amino acids 2-160)
-
Alt namehRNF8
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1212
-
Mutationaa 2-160
-
Entrez GeneRNF8 (a.k.a. hRNF8)
- Promoter TRE promoter, Tet ON
-
Tag
/ Fusion Protein
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW-eGFP-FHA was a gift from Daniel Durocher (Addgene plasmid # 114129 ; http://n2t.net/addgene:114129 ; RRID:Addgene_114129) -
For your References section:
The shieldin complex mediates 53BP1-dependent DNA repair. Noordermeer SM, Adam S, Setiaputra D, Barazas M, Pettitt SJ, Ling AK, Olivieri M, Alvarez-Quilon A, Moatti N, Zimmermann M, Annunziato S, Krastev DB, Song F, Brandsma I, Frankum J, Brough R, Sherker A, Landry S, Szilard RK, Munro MM, McEwan A, Goullet de Rugy T, Lin ZY, Hart T, Moffat J, Gingras AC, Martin A, van Attikum H, Jonkers J, Lord CJ, Rottenberg S, Durocher D. Nature. 2018 Aug;560(7716):117-121. doi: 10.1038/s41586-018-0340-7. Epub 2018 Jul 18. 10.1038/s41586-018-0340-7 PubMed 30022168