pCAG-hChR2(H134R)-EYFP
(Plasmid
#114367)
-
Purposeexpresses channelrhodopsin 2 fused with EYFP
-
Depositing Lab
-
Depositing OrganizationBaylor College of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 114367-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 114367-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4815
- Total vector size (bp) 6477
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namehChR2(H134R)
-
Alt nameChannelrhodopsin 2
-
Alt nameChR2
-
Alt nameChR2(H134R)
-
Insert Size (bp)1662
-
Mutationthe Histidine at amino acid position 134 was changed to Arginine in ChR2
- Promoter pCAG
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI, KpnI, NheI, BmtI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG (pCAG-F)
- 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC (EXFP-R)
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypCAG backbone vector from pCAG-EGFP (Addgene #11150); hChR2*H134R)-EYFP from pAAV-EF1α-DIO-hChR2(H134R)-EYFP (Addgene #20298).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/early/2018/05/25/331165.1 for bioRxiv preprint.
DNA (Catalog # 114367-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 114367-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-hChR2(H134R)-EYFP was a gift from Mingshan Xue (Addgene plasmid # 114367 ; http://n2t.net/addgene:114367 ; RRID:Addgene_114367) -
For your References section:
Targeting light-gated chloride channels to neuronal somatodendritic domain reduces their excitatory effect in the axon. Messier JE, Chen H, Cai ZL, Xue M. Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506. 10.7554/eLife.38506 PubMed 30091701