Skip to main content

pCAG-hChR2(H134R)-EYFP
(Plasmid #114367)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114367 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 114367-D50 50 μg of DNA in Tris buffer $495
DNA 114367-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4815
  • Total vector size (bp) 6477
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    hChR2(H134R)
  • Alt name
    Channelrhodopsin 2
  • Alt name
    ChR2
  • Alt name
    ChR2(H134R)
  • Insert Size (bp)
    1662
  • Mutation
    the Histidine at amino acid position 134 was changed to Arginine in ChR2
  • Promoter pCAG
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI, KpnI, NheI, BmtI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GCAACGTGCTGGTTATTGTG (pCAG-F)
  • 3′ sequencing primer GTCTTGTAGTTGCCGTCGTC (EXFP-R)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pCAG backbone vector from pCAG-EGFP (Addgene #11150); hChR2*H134R)-EYFP from pAAV-EF1α-DIO-hChR2(H134R)-EYFP (Addgene #20298).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-hChR2(H134R)-EYFP was a gift from Mingshan Xue (Addgene plasmid # 114367 ; http://n2t.net/addgene:114367 ; RRID:Addgene_114367)
  • For your References section:

    Targeting light-gated chloride channels to neuronal somatodendritic domain reduces their excitatory effect in the axon. Messier JE, Chen H, Cai ZL, Xue M. Elife. 2018 Aug 9;7. pii: 38506. doi: 10.7554/eLife.38506. 10.7554/eLife.38506 PubMed 30091701