pCAG-Tet-on Advanced -BGH-PA
(Plasmid
#114379)
-
PurposeExpress reverse tetracycline inducible rtTA transcriptional activator
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 114379 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 114379-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 114379-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTet-On Advanced
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5255
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namertTA and BGH-pA
-
Insert Size (bp)2796
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (destroyed during cloning)
- 3′ cloning site SacU (not destroyed)
- 5′ sequencing primer ggagtgtatactggcttaactat
- 3′ sequencing primer gggatatatcaacggtggtatat
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This construct is also called CAG-rtTA and has been used in our recent published paper ID 29386396.
DNA (Catalog # 114379-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 114379-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Tet-on Advanced -BGH-PA was a gift from Yuet Wai Kan (Addgene plasmid # 114379 ; http://n2t.net/addgene:114379 ; RRID:Addgene_114379) -
For your References section:
Generation of induced pluripotent stem cells using site-specific integration with phage integrase. Ye L, Chang JC, Lin C, Qi Z, Yu J, Kan YW. Proc Natl Acad Sci U S A. 2010 Nov 9;107(45):19467-72. Epub 2010 Oct 25. 10.1073/pnas.1012677107 PubMed 20974949