pAAVS1-TRE-MA4-GFP
(Plasmid #114380)

• Purpose: Doxycycline inducible MLL-AF4 and GFP expression. The construct has been used with CAG-rtTA for making engraftable iPSC derived HSCs.
• Depositing Lab: Yuet Wai Kan
• Publication: Tan et al Proc Natl Acad Sci U S A. 2018 Feb 27;115(9):2180-2185. doi: 10.1073/pnas.1718446115. Epub 2018 Jan 31.

Backbone

• Vector backbone: AAVS1 SA-2A-puro-pA
• Backbone manufacturer: Rudolf Jaenisch, Addgene Plasmid #22075
• Backbone size w/o insert (bp): 6602
• Modifications to backbone: This construct contains AAVS1 homology arms, but they don't affect the inserted gene expression.
• Vector type: Mammalian Expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: MLL-AF4 fusion gene
• Species: H. sapiens (human)
• Insert Size (bp): 8267
• Entrez Gene: AFF1 (a.k.a. AF4, FEL, MLLT2, PBM1)
• Promoter: TRE
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sal I (destroyed during cloning)
• 3′ cloning site: Sal I (destroyed during cloning)
• 5′ sequencing primer: gcatcgcattgtctgagtaggt
• 3′ sequencing primer: gcaaaccttagaggttctggcaaggaga

Resource Information

• Supplemental Documents:
  • AAVS1-TRE-MA4-EGFP.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry