Skip to main content

pAAVS1-TRE-MA4-GFP
(Plasmid #114380)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114380 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    AAVS1 SA-2A-puro-pA
  • Backbone manufacturer
    Rudolf Jaenisch, Addgene Plasmid #22075
  • Backbone size w/o insert (bp) 6602
  • Modifications to backbone
    This construct contains AAVS1 homology arms, but they don't affect the inserted gene expression.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MLL-AF4 fusion gene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8267
  • Entrez Gene
    AFF1 (a.k.a. AF4, FEL, MLLT2, PBM1)
  • Promoter TRE
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (destroyed during cloning)
  • 3′ cloning site Sal I (destroyed during cloning)
  • 5′ sequencing primer gcatcgcattgtctgagtaggt
  • 3′ sequencing primer gcaaaccttagaggttctggcaaggaga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-TRE-MA4-GFP was a gift from Yuet Wai Kan (Addgene plasmid # 114380 ; http://n2t.net/addgene:114380 ; RRID:Addgene_114380)
  • For your References section:

    Respecifying human iPSC-derived blood cells into highly engraftable hematopoietic stem and progenitor cells with a single factor. Tan YT, Ye L, Xie F, Beyer AI, Muench MO, Wang J, Chen Z, Liu H, Chen SJ, Kan YW. Proc Natl Acad Sci U S A. 2018 Feb 27;115(9):2180-2185. doi: 10.1073/pnas.1718446115. Epub 2018 Jan 31. 10.1073/pnas.1718446115 PubMed 29386396