Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pAAVS1-TRE-MA4-GFP
(Plasmid #114380)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 114380 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    AAVS1 SA-2A-puro-pA
  • Backbone manufacturer
    Rudolf Jaenisch, Addgene Plasmid #22075
  • Backbone size w/o insert (bp) 6602
  • Modifications to backbone
    This construct contains AAVS1 homology arms, but they don't affect the inserted gene expression.
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MLL-AF4 fusion gene
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    8267
  • Promoter TRE
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal I (destroyed during cloning)
  • 3′ cloning site Sal I (destroyed during cloning)
  • 5′ sequencing primer gcatcgcattgtctgagtaggt
  • 3′ sequencing primer gcaaaccttagaggttctggcaaggaga
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAVS1-TRE-MA4-GFP was a gift from Yuet Wai Kan (Addgene plasmid # 114380 ; http://n2t.net/addgene:114380 ; RRID:Addgene_114380)
  • For your References section:

    Respecifying human iPSC-derived blood cells into highly engraftable hematopoietic stem and progenitor cells with a single factor. Tan YT, Ye L, Xie F, Beyer AI, Muench MO, Wang J, Chen Z, Liu H, Chen SJ, Kan YW. Proc Natl Acad Sci U S A. 2018 Feb 27;115(9):2180-2185. doi: 10.1073/pnas.1718446115. Epub 2018 Jan 31. 10.1073/pnas.1718446115 PubMed 29386396