Skip to main content
Addgene
Open Menu

mOtop1_pcDNA3
(Plasmid #114677)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 114677 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 114677-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 114677-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size w/o insert (bp) 5429
  • Total vector size (bp) 7232
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Otopetrin 1
  • Alt name
    Otop1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1803
  • Mutation
    SNP (rs49325632): Glycine 396 to Alanine
  • GenBank ID
    NM_172709
  • Entrez Gene
    Otop1 (a.k.a. A530025J20Rik, Otp1, tlt)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taatacgactcactataggg
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: mOtop1 contains G396A which is a known mutation/SNP

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mOtop1_pcDNA3 was a gift from Emily Liman (Addgene plasmid # 114677 ; http://n2t.net/addgene:114677 ; RRID:Addgene_114677)

  • For your References section:

    An evolutionarily conserved gene family encodes proton-selective ion channels. Tu YH, Cooper AJ, Teng B, Chang RB, Artiga DJ, Turner HN, Mulhall EM, Ye W, Smith AD, Liman ER. Science. 2018 Mar 2;359(6379):1047-1050. doi: 10.1126/science.aao3264. Epub 2018 Jan 25. 10.1126/science.aao3264 PubMed 29371428
Related items:
Commonly requested with: