pPBbsr-mKO-MK2
(Plasmid #115492)

• Purpose: Expression vector for the p38 activity reporter mKO-MK2 in mammalian cells
• Depositing Lab: Kazuhiro Aoki
• Publication: Miura et al Cell Rep. 2018 Sep 4;24(10):2658-2668. doi: 10.1016/j.celrep.2018.08.020.

Backbone

• Vector backbone: pPB
• Backbone manufacturer: Allan Bradley (Wellcome Sanger Institute)
• Backbone size w/o insert (bp): 6752
• Total vector size (bp): 8615
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mKO-MK2
• Alt name: MAPKAPK2
• Alt name: mitogen-activated protein kinase-activated protein kinase 2
• Species: H. sapiens (human)
• Insert Size (bp): 1863
• GenBank ID: NM_032960.3
• Entrez Gene: MAPKAPK2 (a.k.a. MAPKAP-K2, MK-2, MK2)
• Promoter: CAG
• Tag / Fusion Protein:
  • monomeric Kusabira Orange (mKO) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: catgttcatgccttcttctttttcc
• 3′ sequencing primer: gggccctcacattgccaaa

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry