pPBbsr-JNK KTR-mCherry
(Plasmid #115493)

• Purpose: Expression vector for the JNK activity reporter JNK KTR-mCherry in mammalian cells
• Depositing Lab: Kazuhiro Aoki
• Publication: Miura et al Cell Rep. 2018 Sep 4;24(10):2658-2668. doi: 10.1016/j.celrep.2018.08.020.

Backbone

• Vector backbone: pPB
• Backbone manufacturer: Allan Bradley (Wellcome Sanger Institute)
• Backbone size w/o insert (bp): 6777
• Total vector size (bp): 7668
• Vector type: Mammalian Expression
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: JNK KTR-mCherry
• Alt name: JNK Kinase Translocation Reporter
• Species: M. musculus (mouse), Synthetic
• Insert Size (bp): 891
• Mutation: mCherry G229L, mCherry Y298 deleted
• GenBank ID:
• Promoter: CAG
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: catgttcatgccttcttctttttcc
• 3′ sequencing primer: gggccctcacattgccaaa

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Markus Covert (Stanford University)
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See also: Regot et al Cell. 2014 Jun 19;157(7):1724-34. doi: 10.1016/j.cell.2014.04.039.