Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPBbsr-mKO-MK2
(Plasmid #115492)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 115492 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pPB
  • Backbone manufacturer
    Allan Bradley (Wellcome Sanger Institute)
  • Backbone size w/o insert (bp) 6752
  • Total vector size (bp) 8615
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mKO-MK2
  • Alt name
    MAPKAPK2
  • Alt name
    mitogen-activated protein kinase-activated protein kinase 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1863
  • GenBank ID
    NM_032960.3
  • Entrez Gene
    MAPKAPK2 (a.k.a. MAPKAP-K2, MK-2, MK2)
  • Promoter CAG
  • Tag / Fusion Protein
    • monomeric Kusabira Orange (mKO) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer catgttcatgccttcttctttttcc
  • 3′ sequencing primer gggccctcacattgccaaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPBbsr-mKO-MK2 was a gift from Kazuhiro Aoki (Addgene plasmid # 115492 ; http://n2t.net/addgene:115492 ; RRID:Addgene_115492)
  • For your References section:

    Cell-to-Cell Heterogeneity in p38-Mediated Cross-Inhibition of JNK Causes Stochastic Cell Death. Miura H, Kondo Y, Matsuda M, Aoki K. Cell Rep. 2018 Sep 4;24(10):2658-2668. doi: 10.1016/j.celrep.2018.08.020. 10.1016/j.celrep.2018.08.020 PubMed 30184500