-
PurposeExpression vector for the p38 activity reporter mKO-MK2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 115492 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepPB
-
Backbone manufacturerAllan Bradley (Wellcome Sanger Institute)
- Backbone size w/o insert (bp) 6752
- Total vector size (bp) 8615
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemKO-MK2
-
Alt nameMAPKAPK2
-
Alt namemitogen-activated protein kinase-activated protein kinase 2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1863
-
GenBank IDNM_032960.3
-
Entrez GeneMAPKAPK2 (a.k.a. MAPKAP-K2, MK-2, MK2)
- Promoter CAG
-
Tag
/ Fusion Protein
- monomeric Kusabira Orange (mKO) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer catgttcatgccttcttctttttcc
- 3′ sequencing primer gggccctcacattgccaaa (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPBbsr-mKO-MK2 was a gift from Kazuhiro Aoki (Addgene plasmid # 115492 ; http://n2t.net/addgene:115492 ; RRID:Addgene_115492) -
For your References section:
Cell-to-Cell Heterogeneity in p38-Mediated Cross-Inhibition of JNK Causes Stochastic Cell Death. Miura H, Kondo Y, Matsuda M, Aoki K. Cell Rep. 2018 Sep 4;24(10):2658-2668. doi: 10.1016/j.celrep.2018.08.020. 10.1016/j.celrep.2018.08.020 PubMed 30184500