pmiRGLO-GRM4-202
(Plasmid
#117347)
-
PurposeDual luciferase assay for miRNA-targeted UTR
-
Depositing Lab
-
Depositing OrganizationTechnische Universitaet Dresden
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117347 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 117347-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 117347-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepmiRGLO
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 7334
-
Vector typeMammalian Expression, Luciferase
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name3' UTR GRM4-202
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4174
- Promoter Murine PGK-1
-
Tag
/ Fusion Protein
- luciferase (N terminal on backbone)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer Fluc-F1 (AGAAGCTGCGCGGTGGTGTTGTG)
- 3′ sequencing primer T7terminal
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
5' NheI cloning site destroyed, 3' XbaI cloning site destroyed
DNA (Catalog # 117347-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 117347-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmiRGLO-GRM4-202 was a gift from Volker Busskamp (Addgene plasmid # 117347 ; http://n2t.net/addgene:117347 ; RRID:Addgene_117347) -
For your References section:
Combined Experimental and System-Level Analyses Reveal the Complex Regulatory Network of miR-124 during Human Neurogenesis. Kutsche LK, Gysi DM, Fallmann J, Lenk K, Petri R, Swiersy A, Klapper SD, Pircs K, Khattak S, Stadler PF, Jakobsson J, Nowick K, Busskamp V. Cell Syst. 2018 Sep 28. pii: S2405-4712(18)30358-2. doi: 10.1016/j.cels.2018.08.011. 10.1016/j.cels.2018.08.011 PubMed 30292704