pMO9075
(Plasmid #117481)

• Purpose: empty complementation vector for Desulfovibrio: contains promoter from Aph(3')-IIa but no RBS, contains pBG1 and pMB1 replicons, SpecR
• Depositing Lab: Judy Wall
• Publication: Keller et al Methods Enzymol. 2011;497:503-17. doi: 10.1016/B978-0-12-385075-1.00022-6.

Backbone

• Vector backbone: pCR8/GW/TOPO
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 2817
• Total vector size (bp): 4836
• Modifications to backbone: pCR8/GW/TOPO + pBG1 (PCR product) => pMO719 || pMO719 (EcoRV digested) + kanR (PCR product from pCR-XL-TOPO) => pMO9071 || pMO9071 (BsaBI digest, religate) => pMO9072 || pMO9072 (HpaI/XmnI digest, religate) => pMO9072-1a || pMO9072-1a (EcoRV/BspEI digest, blunted, religated) => pMO9073 || pMO9073 (EcoRI digest, religate) => pMO9075
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Stable in Desulfovibrio vulgaris Hildenborough (low copy number). Use spectinomycin at 100 ug/ml. Promoter for exogenous expression of genes is strong, but is lacking a ribosomal binding site. See primers listed in Korte et al. (2014) for complementation of rex (primers SLIC DVU0916-comp-F and SLIC DVU0916-comp-R) for suggested primers.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Aph(3')-IIa promoter
• Alt name: Paph
• Alt name: Pkan
• Species: Escherichia coli
• Insert Size (bp): 50
• GenBank ID: NC_008460.1
• Promoter: Aph(3')-IIa promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Blunt-end cloned (destroyed during cloning)
• 3′ cloning site: Blunt-end cloned (destroyed during cloning)
• 5′ sequencing primer: AGACACGGGCCAGAGCTG
• 3′ sequencing primer: GCTGAAAGCGAGAAGAGCGCAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry