BCJJ344
(Plasmid
#117503)
-
PurposeUBI10:Cas9:E9 Golden Gate Level 1 Position 2 reverse
-
Depositing Lab
-
Depositing OrganizationSainsbury Laboratory, Norwich
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICH47811
- Backbone size w/o insert (bp) 4352
- Total vector size (bp) 10797
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBpiI:tagt:UBI10:Cas9-3(intron):E9:ttgc:BpiI
-
SpeciesSynthetic
-
Insert Size (bp)6445
- Promoter AtUBI10
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (not destroyed)
- 3′ cloning site BpiI (not destroyed)
- 5′ sequencing primer GTGGTGTAAACAAATTGACGC
- 3′ sequencing primer GGATAAACCTTTTCACGCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by Baptiste Castel . Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
BCJJ344 was a gift from Jonathan D Jones (Addgene plasmid # 117503 ; http://n2t.net/addgene:117503 ; RRID:Addgene_117503) -
For your References section:
Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. Castel B, Tomlinson L, Locci F, Yang Y, Jones JDG. PLoS One. 2019 Jan 9;14(1):e0204778. doi: 10.1371/journal.pone.0204778. eCollection 2019. 10.1371/journal.pone.0204778 PubMed 30625150