LBJJ382
(Plasmid
#117518)
-
PurposeAlso known as LBJJ429. PCR template for sgRNA-EF with polyT, 67bp or 192bp terminator
-
Depositing Lab
-
Depositing OrganizationSainsbury Laboratory, Norwich
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 117518 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICH47751
- Backbone size w/o insert (bp) 4352
- Total vector size (bp) 4880
-
Vector typePlant Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameBpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
-
SpeciesSynthetic
-
Insert Size (bp)528
- Promoter AtU6-26
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (not destroyed)
- 3′ cloning site BpiI (not destroyed)
- 5′ sequencing primer GTGGTGTAAACAAATTGACGC
- 3′ sequencing primer GGATAAACCTTTTCACGCCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloned by Laurence Tomlinson.
Primers to amplify a sgRNA:
Fw: ga GGTCTCa ATTG [x] GTTTAAGAGCTATGCTGGAA, where [x] is the 20nt spacer/target sequence (NOT including the PAM).
Rv: tgtggtctcaAGCGAAAAAAAGCACCGACTC (for polyT terminator)
tgtggtctcaAGCGACCCCAGAAATTGAAC (for 67 bp U6-26 terminator, recommanded)
tgtggtctcaAGCGTATTGGTTTATCTCATCG (for 192 bp U6-26 terminator).
The PCR amplicon is ready to clone in a Golden Gate fashion with U6-26 promoter (pICSL90002) and any Golden Gate compatible acceptor vector Level 1, using BsaI. Please visit https://www.biorxiv.org/content/early/2018/09/17/419952 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LBJJ382 was a gift from Jonathan D Jones (Addgene plasmid # 117518 ; http://n2t.net/addgene:117518 ; RRID:Addgene_117518) -
For your References section:
Optimization of T-DNA architecture for Cas9-mediated mutagenesis in Arabidopsis. Castel B, Tomlinson L, Locci F, Yang Y, Jones JDG. PLoS One. 2019 Jan 9;14(1):e0204778. doi: 10.1371/journal.pone.0204778. eCollection 2019. 10.1371/journal.pone.0204778 PubMed 30625150