Skip to main content

pGTag-eGFP-CAAX-SV40
(Plasmid #117815)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 117815 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 117815-D50 50 μg of DNA in Tris buffer $495
DNA 117815-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pK
  • Backbone manufacturer
    Karl J. Clark
  • Backbone size w/o insert (bp) 2958
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    eGFP
  • Alt name
    GFP
  • Species
    H. sapiens (human), D. rerio (zebrafish)
  • Insert Size (bp)
    1206
  • Tag / Fusion Protein
    • CAAX (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCATGGATGTTTTCCCAGTC
  • 3′ sequencing primer atggctcataacaccccttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Online tools and cloning help available at <www.genesculpt.org/gtaghd/>. May work in additional species beyond those listed. Please visit https://www.biorxiv.org/content/10.1101/431627v2 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGTag-eGFP-CAAX-SV40 was a gift from Jeffrey Essner (Addgene plasmid # 117815 ; http://n2t.net/addgene:117815 ; RRID:Addgene_117815)
  • For your References section:

    Efficient targeted integration directed by short homology in zebrafish and mammalian cells. Wierson WA, Welker JM, Almeida MP, Mann CM, Webster DA, Torrie ME, Weiss TJ, Kambakam S, Vollbrecht MK, Lan M, McKeighan KC, Levey J, Ming Z, Wehmeier A, Mikelson CS, Haltom JA, Kwan KM, Chien CB, Balciunas D, Ekker SC, Clark KJ, Webber BR, Moriarity BS, Solin SL, Carlson DF, Dobbs DL, McGrail M, Essner J. Elife. 2020 May 15;9. pii: 53968. doi: 10.7554/eLife.53968. 10.7554/eLife.53968 PubMed 32412410