-
PurposeCircularly permutated firefly luciferase with TEV cleavage site (Luciferase reporter for detection of proteolytic activity)
-
Depositing Lab
-
Depositing OrganizationNational Institute of Chemistry
Located in Slovenia -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 119207 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 7780
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecyclic luciferase with TEVs cleavage site
-
Alt namecycLuc_TEVs
-
Insert Size (bp)2298
- Promoter CMV
-
Tags
/ Fusion Proteins
- AU1 tag (N terminal on insert)
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cycLuc_TEVS was a gift from Roman Jerala (Addgene plasmid # 119207 ; http://n2t.net/addgene:119207 ; RRID:Addgene_119207) -
For your References section:
Design of fast proteolysis-based signaling and logic circuits in mammalian cells. Fink T, Lonzaric J, Praznik A, Plaper T, Merljak E, Leben K, Jerala N, Lebar T, Strmsek Z, Lapenta F, Bencina M, Jerala R. Nat Chem Biol. 2019 Feb;15(2):115-122. doi: 10.1038/s41589-018-0181-6. Epub 2018 Dec 10. 10.1038/s41589-018-0181-6 PubMed 30531965